Viewing Text Files
In this section, we will learn to view text files using
catheadtailless
While “text files” may not sound exciting, most bioinformatics data formats are simple text files. We will be using actual data files pulled from NCBI in our exercises, so a basic understanding will be beneficial.
Data Formats
We will initially focus on these four data formats. More types can be found on the UCSC genome site.
FASTA
A “FASTA file” is a text-based file with the .fa or .fasta extension that represents sequences of nucleotides using single-letter codes. The basic format is as follows:
- A header line beginning with
> - Any number of lines of sequence characters. Usually
- A - Adenine
- G - Guanine
- C - Cytosine
- T - Thymine
- N - Unknown Base
An example FASTA could look like
>Sequence1
AAGGTTCC
>Sequence2
AAAAAAAAAAAAA
AAAAAAAAAAAAA
AAAAAAAAAAAAA
There cannot be extra lines in this file. More information can be found on the Wikipedia page.
FASTQ
The “FASTQ” format is similar to “FASTA” except it was specifically designed for shorter sequences and certainty (quality) scores.
These files have a .fq or .fastq extension and contain four lines per read:
- Header beginning with
@containing a unique name - Actual sequence with FASTA coding
- Second header beginning with
+(does not need any content) - Character encoded quality scores
Two reads in an example FASTQ could look like
@SRR2014925.235
GATCACAGAAGAAGCCAGTTCGATTTGTTGAGCGCGTAATGACGCGAGATCCATAATCGC
+
>3>AAFFFFFFFCGGCGGGGGGHHHEHDGGHHHGGGGGGGHHHGGGGGGGHHHHHHHHGG
@SRR2014925.236
GTGGTAATGCGCAAGCTGAAAGATTAATTCGGAGTAGGTCGGATAAGACGCGCCAGCGCC
+
3AAAAFFFFFBAEG?GGGGGGGCGHGHHHHGHGGGHHGHGGGGGGHHHHEGGGGGGGGGG
Notice that the second header line can be empty, and the quality scores are on the Phred+33 scale default for (fastq-dump), where the characters correspond the following values.
This allows a single character represent a two-digit number.
Characters !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHI
| | | |
Values 0........................26...31.......40
BED
One of the most versatile bioinformatics formats is the “BED” (Browser Extensible Data) format, which is used to describe regions of a FASTA sequence. At a minimum, each line of a BED file must have three columns separated by tabs:
- Chromosome (sequence)
- Start position (0-indexed)
- Ending position (not-inclusive meaning [0,5) for first 5)
An example BED file that corresponded to our example FASTA could be
Sequence1 0 4
Sequence1 4 8
which would select the following regions
Sequence1 AAGGTTCC
Index 012345678
BED1 AAGG)
BED2 TTCC)
Where the ) index is excluded and serves as the ending boundary.
More columns can also be added to this format to represent sequencing depth, reference strand, and more
GFF3
GFF3 files (.gff, .gff3) are tab-delimited like BED file, but are 1-indexed and contain 9 columns by default.
They are also meant to refer to other regions instead of being independent of each other, making them ideal to annotate genomes with transcripts, gene-models, exons, and more.
Each line of a GFF3 file contains the following columns
- Chromosome (sequence)
- Source (program or machine)
- Feature Type {exon, gene, mRNA, …}
- Start (1-indexed)
- End (1-indexed and inclusive)
- Score (float or
.for nothing) - Strand (
+or-) - Coding phase (0, 1, 2, or
.for NA) - Attributes (key-value pairs separated by semicolons)
An example GFF3 could look like
##gff-version 3
Sequence1 . gene 1 4 . + . ID=region01
Sequence1 . gene 5 8 . + . ID=region02
Header sequences are prefixed by # characters. More information about the GFF3 format can be found here.
Viewing Files
Now that you have a basic understanding of these file formats, lets learn to view them. We first need some files to work with, so lets download some data I pre-formatted.
cp /work/03076/gzynda/public/data/ctls2017/* .
Printing a whole file
When necessary, you can print an entire file with the cat command.
The cat command reads input sequentially and writes the contents to the standard output.
This is great to quickly print an entire file.
$ cat fileA.bed
You will quickly learn that cat can sometimes be overwhelming when files are huge.
$ cat SRR2014925_1.fastq
For big files like this, you can either wait for it to finish printing or hit ctrl+C to kill the program.
cat, which is named for concatenate, can also be used to print multiple files in [sequential] order.
$ cat fileA.bed fileB.bed
Notice that files are printed in the order you specify on the command line.
$ cat fileB.bed fileA.bed
You can also use wildcards to represent multiple files.
$ cat file[AB].bed
$ cat file*.bed
$ cat file*
$ cat *bed
If you try all of the above commands, you will notice that they all resolve to the same output.
Printing part of a file
For times when the whole file is too much information, you can print the first few lines using the head command.
$ head fileA.bed
If you are only interested in the end of a file, the tail command will print the last few lines of a file.
$ tail fileA.bed
If you specify multiple files at once, head will automatically prepend the filename before the selected lines.
cat does not do this because it was specifically designed to concatenate file contents without extra artefacts.
$ cat file*.bed
$ head file*.bed
You can also specify the number of lines you wish to print with the -n argument.
$ head -n 2 fileA.bed
$ tail -n 2 fileA.bed
Explore
- How many lines get printed by default?
- What happens when you file has fewer lines?
- Find other useful parameters by looking at the documentation (
man head).
Browsing through a file
Instead of printing an entire file, or a specific part of a file, you can also browse though it with the less command.
less does not automatically exit like cat and head, so lets take a quick look at the documentation and some important commands.
| Key | Description |
|---|---|
| Q | Quit |
| ↑ ↓ | Move up or down a line |
| ← → | Scroll left or right |
| space bar | Scroll down a “page” |
| B | Scroll up a “page” |
Try using it on fileA.bed
$ less fileA.txt
The whole file should be visible in a single terminal, so you should be unable to scroll. Try using it on the E. coli annotation file.
$ less ecoli.gff3
You can also search for specific patterns with less.
| Key | Description |
|---|---|
/<text> |
Search for <text> in the file |
| N | Next match |
| shift+N | Previous match |
Try to find “exon” and “gene” regions in ecoli.gff3.
The more you use less, the more you will appreciate less. :D
Explore
- Try searching for a regular expression
- Use less on a “SAM” file with and without the
-Sargument
Text vs Binary
While most files are text format, you can encounter binary files that will break your workflow. What would that look like?
$ head SRR2014925.sam
$ head SRR2014925.bam
Notice that printing out the non-ASCII characters in the binary BAM will corrupt your terminal window. The quickest way to fix this is by resetting it.
$ reset
You will learn to recognize which file formats are text vs binary, but you can always check with the file command, which doesn’t corrupt your terminal.
$ file SRR2014925.sam
SRR2014925.sam: ASCII text, with very long lines
$ file SRR2014925.bam
SRR2014925.bam: gzip compressed data, extra field
Exercises
- Print the first 2 reads of a fastq file
- Print the last read of a fastq file
- What chromosome in
ecoli.fastacontainsTCCAACTTATTGATAGTGTTTTATGTTCAGATAATGCCGATG?